insertion calls Search Results


bionano insertion calls  (BioNano Genomics)
90
BioNano Genomics bionano insertion calls
Bionano Insertion Calls, supplied by BioNano Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insertion+calls/bionano+insertion+calls/pmc06072799__41467_2018_5513_MOESM2_ESM-407-19-19
Average 90 stars, based on 1 article reviews
bionano insertion calls - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
cysteine-rich 59-amino-acid insert between rck domains called strex variant  (STREX Inc)
90
STREX Inc cysteine-rich 59-amino-acid insert between rck domains called strex variant
Cysteine Rich 59 Amino Acid Insert Between Rck Domains Called Strex Variant, supplied by STREX Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insertion+calls/cysteine+rich+59+amino+acid+insert+between+rck+domains+called+strex+variant/pmc08596180-178-3-10
Average 90 stars, based on 1 article reviews
cysteine-rich 59-amino-acid insert between rck domains called strex variant - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
shrna plasmids for mrj with an insert sequence called m1  (SuperArray Bioscience Corporation)
90
SuperArray Bioscience Corporation shrna plasmids for mrj with an insert sequence called m1
A. Western blot of lysates from three IMCD3 cultures all expressing <t>GC1-GFP;</t> <t>shRNA</t> control (Con Vec), shRNA knockdown vector <t>(MRJ</t> Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.
Shrna Plasmids For Mrj With An Insert Sequence Called M1, supplied by SuperArray Bioscience Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insertion+calls/shrna+plasmids+for+mrj+with+an+insert+sequence+called+m1/pmc02827254-776-4-22
Average 90 stars, based on 1 article reviews
shrna plasmids for mrj with an insert sequence called m1 - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
insertion call set  (BioNano Genomics)
90
BioNano Genomics insertion call set
A. Western blot of lysates from three IMCD3 cultures all expressing <t>GC1-GFP;</t> <t>shRNA</t> control (Con Vec), shRNA knockdown vector <t>(MRJ</t> Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.
Insertion Call Set, supplied by BioNano Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insertion+calls/insertion+call+set/pmc06072799__41467_2018_5513_MOESM1_ESM-26-305-304
Average 90 stars, based on 1 article reviews
insertion call set - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
insertion calls  (BioNano Genomics)
90
BioNano Genomics insertion calls
A. Western blot of lysates from three IMCD3 cultures all expressing <t>GC1-GFP;</t> <t>shRNA</t> control (Con Vec), shRNA knockdown vector <t>(MRJ</t> Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.
Insertion Calls, supplied by BioNano Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insertion+calls/insertion+calls/pm33127893-340-7-7
Average 90 stars, based on 1 article reviews
insertion calls - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
tungsten carbide milling insert with 15 rake face angle, chamfer width (also called as t-land)  (Kennametal Inc)
90
Kennametal Inc tungsten carbide milling insert with 15 rake face angle, chamfer width (also called as t-land)
A. Western blot of lysates from three IMCD3 cultures all expressing <t>GC1-GFP;</t> <t>shRNA</t> control (Con Vec), shRNA knockdown vector <t>(MRJ</t> Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.
Tungsten Carbide Milling Insert With 15 Rake Face Angle, Chamfer Width (Also Called As T Land), supplied by Kennametal Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insertion+calls/tungsten+carbide+milling+insert+with+15+rake+face+angle++chamfer+width++also+called+as+t+land+/10__1016_slash_j__cirpj__2020__06__004-61-13-0
Average 90 stars, based on 1 article reviews
tungsten carbide milling insert with 15 rake face angle, chamfer width (also called as t-land) - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
pet membrane inserts coated with hyaluronic acid-based hydrogel called healon 5  (Abbott Laboratories)
90
Abbott Laboratories pet membrane inserts coated with hyaluronic acid-based hydrogel called healon 5
A. Western blot of lysates from three IMCD3 cultures all expressing <t>GC1-GFP;</t> <t>shRNA</t> control (Con Vec), shRNA knockdown vector <t>(MRJ</t> Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.
Pet Membrane Inserts Coated With Hyaluronic Acid Based Hydrogel Called Healon 5, supplied by Abbott Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insertion+calls/pet+membrane+inserts+coated+with+hyaluronic+acid+based+hydrogel+called+healon+5/pm31734324-60-12-23
Average 90 stars, based on 1 article reviews
pet membrane inserts coated with hyaluronic acid-based hydrogel called healon 5 - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
snvs and insertion/deletion polymorphisms called with pepper-margin-deepvariant v0.8  (Pacific Biosciences)
90
Pacific Biosciences snvs and insertion/deletion polymorphisms called with pepper-margin-deepvariant v0.8
A. Western blot of lysates from three IMCD3 cultures all expressing <t>GC1-GFP;</t> <t>shRNA</t> control (Con Vec), shRNA knockdown vector <t>(MRJ</t> Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.
Snvs And Insertion/Deletion Polymorphisms Called With Pepper Margin Deepvariant V0.8, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/insertion+calls/snvs+and+insertion+deletion+polymorphisms+called+with+pepper+margin+deepvariant+v0+8/pm38937606-151-13-23
Average 90 stars, based on 1 article reviews
snvs and insertion/deletion polymorphisms called with pepper-margin-deepvariant v0.8 - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier

Image Search Results


A. Western blot of lysates from three IMCD3 cultures all expressing GC1-GFP; shRNA control (Con Vec), shRNA knockdown vector (MRJ Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.

Journal:

Article Title: Photoreceptor IFT Complexes Containing Chaperones, Guanylyl Cyclase 1, and Rhodopsin

doi: 10.1111/j.1600-0854.2009.00896.x

Figure Lengend Snippet: A. Western blot of lysates from three IMCD3 cultures all expressing GC1-GFP; shRNA control (Con Vec), shRNA knockdown vector (MRJ Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.

Article Snippet: The shRNA plasmids for MRJ with an insert sequence called M1 (CGTGACGCACTTCCTGTTTGT) and a Negative control with insert sequence (GGAATCTCATTCGATGCATAC) were from Superarray Biosciences (Frederick, MD).

Techniques: Western Blot, Expressing, shRNA, Control, Knockdown, Plasmid Preparation, Stable Transfection, Transfection, Negative Control, Labeling, Quantitative RT-PCR, Staining