Journal:

Article Title: Photoreceptor IFT Complexes Containing Chaperones, Guanylyl Cyclase 1, and Rhodopsin

doi: 10.1111/j.1600-0854.2009.00896.x

Figure Lengend Snippet: A. Western blot of lysates from three IMCD3 cultures all expressing GC1-GFP; shRNA control (Con Vec), shRNA knockdown vector (MRJ Vec) on right compared to control (Con Vec, left) or No Vec (middle). Blotting antibodies are on left. B. IMCD3 cells were stably co-transfected with the GC1-GFP plasmid and the MRJ shRNA negative control plasmid. GC1-GFP (green) co-localizes with cilia labeled with anti-acetylated-α tubulin (red); merged images are on right. Bars= 8 μm. C. IMCD3 cells as in B except that they were co-transfected with the expermental MRJ shRNA (M1); this was the same transfection illustrated on right in A. Real-time RT-PCR of MRJ mRNA showed that MRJ mRNA was reduced 70% in the experimental group compared to the control (not shown). In the knockdown group very little GC1-GFP is detected in cilia; it is expressed as seen in the positive diffuse staining in B (left and right) and in the western blot in A. Bars= 8 μm. D. Higher power images showing GC1-GFP (green) and acetytylated-α tubulin (red) in controls (Con on left) and shRNA treated cultures (right). Bars = 4 μm.

Article Snippet: The shRNA plasmids for MRJ with an insert sequence called M1 (CGTGACGCACTTCCTGTTTGT) and a Negative control with insert sequence (GGAATCTCATTCGATGCATAC) were from Superarray Biosciences (Frederick, MD).

Techniques: Western Blot, Expressing, shRNA, Control, Knockdown, Plasmid Preparation, Stable Transfection, Transfection, Negative Control, Labeling, Quantitative RT-PCR, Staining